../../tmp/servers/virsirnadb/1828570052
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2314 | 1 | cggttaaaggcagtagggttg | 21 | |
| AY112987.1 | Semliki forest virus strain L10, complete genome | 3550 | ..................... | 3570 | 100 |
| Z48163.2 | Semliki forest virus genomic RNA for non-structural polyprotein and s | 3549 | ..................... | 3569 | 100 |
| DQ189082.1 | Semliki forest virus isolate ts10 mutant polyprotein nsP1234 and stru | 3464 | ..................... | 3484 | 100 |
| DQ189084.1 | Semliki forest virus isolate ts13 mutant polyprotein nsP1234 and stru | 3464 | ..................... | 3484 | 100 |
| DQ189086.1 | Semliki forest virus polyprotein nsP1234 and structural polyprotein g | 3464 | ..................... | 3484 | 100 |
| EU350586.1 | Semliki forest virus from Viet Nam, complete genome | 3671 | ..................... | 3691 | 100 |
| NC_003215.1 | Semliki forest virus, complete genome | 3549 | ..................... | 3569 | 100 |